LOGIN TO YOUR ACCOUNT

Username
Password
Remember Me
Or use your Academic/Social account:

CREATE AN ACCOUNT

Or use your Academic/Social account:

Congratulations!

You have just completed your registration at OpenAire.

Before you can login to the site, you will need to activate your account. An e-mail will be sent to you with the proper instructions.

Important!

Please note that this site is currently undergoing Beta testing.
Any new content you create is not guaranteed to be present to the final version of the site upon release.

Thank you for your patience,
OpenAire Dev Team.

Close This Message

CREATE AN ACCOUNT

Name:
Username:
Password:
Verify Password:
E-mail:
Verify E-mail:
*All Fields Are Required.
Please Verify You Are Human:
fbtwitterlinkedinvimeoflicker grey 14rssslideshare1
Urch, Jonathan Edward
Languages: English
Types: Doctoral thesis
Subjects:
Malaria can be regarded as one of the world's worst health problems and its incidence is rising inexorably. It already accounts for the deaths of approximately three children every minute. This situation is exacerbated by the increased frequency of parasite resistance to current antimalarial agents and necessitates the development of new drugs to combat this disease P. falciparum possesses a plastid-like organelle, termed the apicoplast, which contains a small, highly reduced 35kb genome encoding tRNA, DNA polymerases and ribosomal proteins. Nuclear proteins are targeted to the apicoplast using clearly defined N-terminal signal and target peptide sequences. This led to the discovery that the apicoplast may be the site of at least two anabolic pathways isoprenoid synthesis and Type II fatty acid synthesis (FAS). This system is also present in bacteria and plants and differs significantly from the Type I FAS system found in humans. This makes the pathway an attractive target for novel antimalarials. Furthermore, the antibiotic thiolactomycin, inhibits the growth of bacteria via inhibition of Type II FAS. This project describes the characterisation of pfFabF and pfFabH, the p-ketoacyl-ACP synthase enzymes in the Type II FAS pathway of P. falciparum. One of these proteins, pfFabF, was shown to be the target of thiolactomycin inhibition. This enzyme was also capable of catalysing the final step of the unsaturated FAS pathway. Thiolactomycin derivatives synthesised in this project were tested against cultures of the parasite and both the condensing enzymes of P. falciparum. Significant improvements in the inhibitory activity against parasite cultures and one of the condensing enzymes were achieved compared to thiolactomycin. Although the inhibitory effects of these compounds was only in the micromolar range, this study demonstrates that thiolactomycin derivatives may provide lead compounds for the inhibition of P. falciparum by targeting either of the p-ketoacyl-ACP synthase proteins.
  • The results below are discovered through our pilot algorithms. Let us know how we are doing!

    • >TGCTGCAGATCGACTCTGCGACCCAGGCGCTGGAAACCTCTTGCCTGAAACCGTCTGACATCGACATGGTTATCAACGCGTCTTCTACCCCGCAGAACC - - I .....................I ................................... -+---4- -1------- »- ■- - 4- - - ............................ » ............4
    • TTGCAGATCGACTCTGCGACCCAGGCGCTGGAAACCTCTTGCCTGAAACCGTCTGACATCGACATGGT TATCAACGCGTCTTCTACCCCGCAGAACC ......................................... - t -♦ > - 4 ------ <----------I 1 ■• ■ h............................ I- ................... I ...................- - • I 1100
    • GACGTCTA6CTGAGACGCTGGGTCCGCGACCT TTGGAGAACGGACT TTGGCAGACTGTAGCTGTACCAATAGTTGCGCAGAAGATGGGGCGTCTTGG
    • 6a
    • 6b
    • 6c
    • 6d
    • 7a
    • 7b
    • 7c
    • 7d
    • 7e
    • 7f
    • 7h
    • 7i
    • 7j
    • 7k
    • 11b
    • 12a
    • 12b
    • S. M . Jones el al. / Bioorg. Med. Chem. 12 (2004) 683-692 1. WHO Weekly Epidemiol. Rep. 1997, 72, 269.
    • 2. White, N. J. Ann. Trop. Med. Parasitol. 1998, 92, 449.
    • 3. Gardner, M. J.; Hall, N.; Fung, E.; White, O.; Berriman, M.; Hyman, R. W.; Carlton, J. M.; Pain, A.; Nelson, K. E.; Bowman, S.; Paulsen, I. T.; James, K.; Eisen, J. A.; Rutherford, K.; Salzberg, S. L.; Craig, A.; Kyes, S.; Chan, M. S.; Nene, V.; Shallom, S. J.; Suh, B.; Peterson, J.; Angiuoli, S.; Pertea, M.; Allen, J.; Selengut, J.; Haft, D.; Mather, M. W.; Vaidya, A. B.; M artin, D. M. A.; Fairlamb, A. H.; Fraunholz, M. J.; Roos, D. S.; Ralph, S. A.; McFadden, G. I.; Cummings, L. M.; Subramanian, G. M.; Mungall, C.; Venter, J. C.; Carucci, D. J.; Hoffman, S. L.; Newbold, C.; Davis, R. W.; Fraser, C. M.; Barrell, B. Nature 2002, 419, 498.
    • 4. Florens, L.; Washburn, M. P.; Raine, J. D.; Anthony, R. M.; Grainger, M.; Haynes, J. D.; Moch, J. K.; Muster, N.; Sacci, J. B.; Tabb, D. L.; Witney, A. A.; Wolters, D.; Wu, Y. M.; Gardner, M. J.; Holder, A. A.; Sinden, R. E.; Yates, J. R.; Carucci, D. J. Nature 2002, 419, 520.
    • 5. Harwood, J. L. Biochim. Biophys. Acta-Lipids Lipid Metab. 1996, 7, 1301.
    • 6. Clough, B.; Rangachari, K.; Strath, M.; Preiser, P. R.; Wilson, R. Protist 1999, 150, 189.
    • 7. Ralph, S. A.; D 'Ombrain, M. C.; M cFadden, G. I. Drug Resist. Update 2001, 4, 145.
    • 8. Jackowski, S.; Rock, C. O. J. Biol. Chem. 1987, 262, 7927.
    • 9. Kohler, S.; Delwiche, C. F.; Denny, P. W.; Tilney, L. G.; Webster, P.; Wilson, R. J. M.; Palmer, J. D.; Roos, D. S. Science 1997, 275, 1485.
    • 10. McFadden, G. I.; Reith, M. E.; Munholland, J.; LangUnnasch, N. Nature 1996, 381, 482.
    • 11. McFadden, G. I.; Waller, R. F. Bioessays 1997, 19, 1033.
    • 12. Wilson, R. J. M.; Denny, P. W.; Preiser, P. R.; Rangachari, K.; Roberts, K.; Roy, A.; Whyte, A.; Strath, M.; Moore, D. J.; Moore, P. W.; Williamson, D. H. J. Mol. Biol. 1996, 261, 155.
    • 13. Nishida, I.; Kawaguchi, A.; Yamada, M. J. Biochem. (Tokyo) 1986, 99, 1447.
    • 14. Jackowski, S.; Murphy, C. M.; Cronan, J. E.; Rock, C. O. J. Biol. Chem. 1989, 264, 7624.
    • 15. Oishi, H.; Noto, T.; Sasaki, H.; Suzuki, K.; Hayashi, T.; Okazaki, H.; Ando, K.; Sawada, M. J. Antibiot. 1982, 35, 391.
    • 16. Noto, T.; Miyakawa, S.; Oishi, H.; Endo, H.; Okazaki, H. J. Antibiot. 1982, 35, 401.
    • 17. Kremer, L.; Douglas, J. D.; Baulard, A. R.; Morehouse, C.; Guy, M. R.; Alland, D.; Dover, L. G.; Lakey, J. H.; Jacobs, W. R.; Brennan, P. J.; Minnikin, D. E.; Besra, G. S. J. Biol. Chem. 2000, 275, 16857.
    • 18. Jones, A. L.; Herbert, D.; Rutter, A. J.; Dancer, J. E.; Harwood, J. L. Biochem. J. 2000, 347, 205.
    • 19. Sakya, S. M.; Suarez-Contreras, M.; Dirlam, J. P.; O'Connell, T. N.; Hayashi, S. F.; Santoro, S. L.; Kamicker, B. J.; George, D. M.; Ziegler, C. B. Bioorg. Med. Chem. Lett. 2001, 11, 2751.
    • 20. Waller, R. F.; Ralph, S. A.; Reed, M. B.; Su, V.; Douglas, J. D.; Minnikin, D. E.; Cowman, A. F.; Besra, G. S.; McFadden, G. I. Antimicrob. Agents Chemother. 2003, 47, 297.
    • 21. Wang, C. L. J.; Salvino, J. M. Tetrahedron Lett. 1984, 25, 5243.
    • 22. Benary, E. Berichte 1913, 46, 2103.
    • 23. Josien, H.; Curran, D. P. Tetrahedron 1997, 53, 8881.
    • 24. Price, A. C.; Zhang, Y. M.; Rock, C. O.; White, S. W. Biochemistry 2001, 40, 12772.
    • 25. Price, A. C.; Choi, K. H.; Heath, R. J.; Li, Z. M.; White, S. W.; Rock, C. O. J. Biol. Chem. 2001, 276, 6551.
    • 26. Morita, Y. S.; Paul, K. S.; Englund, P. T. Science 2000, 288, 140.
    • 27. Desjardins, R. E.; Canfield, C. J.; Haynes, D.; Chulay, J. Antimicrob. Agents Chemother. 1979, 16,1X0.
    • 28. Matile, H.; Pink, J. R. L. Plasmodium Falciparum Malaria Parasite Cultures and Their Use in Immunology. In Immunological Methods', Academic: San Diego, 1990; p 221.
    • 29. Baltz, T.; Baltz, D.; Giroud, C.; Crockett, J. EMBO J. 1985, 4, 1273.
    • 30. Raz, B.; Iten, M.; Grether-Buhler, Y.; Kaminski, R.; Brun, R. Acta Trop. 1997, 68, 139.
  • No related research data.
  • No similar publications.

Share - Bookmark

Cite this article